BMRB Entry 4816
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4816
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structural Features of an Influenza Virus Promoter and their Implications for Viral RNA Synthesis PubMed: 11553808
Deposition date: 2000-08-23 Original release date: 2002-04-04
Authors: Bae, S.-H.; Cheong, H.-K.; Lee, J.-H.; Cheong, C.; Kainosho, M.; Choi, B.-S.
Citation: Bae, S.-H.; Cheong, H.-K.; Lee, J.-H.; Cheong, C.; Kainosho, M.; Choi, B.-S.. "Structural Features of an Influenza Virus Promoter and Their Implications for Viral RNA Synthesis" Proc. Natl. Acad. Sci. U.S.A. 98, 10602-10607 (2001).
Assembly members:
INFLUENZA A VIRUS PROMOTER RNA, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: 11320 Superkingdom: viruses Kingdom: not available Genus/species: Influenza virus type A Influenza A virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
INFLUENZA A VIRUS PROMOTER RNA: AGUAGAAACAAGGCUUCGGC
CUGCUUUUGCU
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 39 |
15N chemical shifts | 23 |
31P chemical shifts | 22 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | VRNA | 1 |
Entities:
Entity 1, VRNA 31 residues - Formula weight is not available
1 | A | G | U | A | G | A | A | A | C | A | ||||
2 | A | G | G | C | U | U | C | G | G | C | ||||
3 | C | U | G | C | U | U | U | U | G | C | ||||
4 | U |
Samples:
vRNA-H2O: INFLUENZA A VIRUS PROMOTER RNA 2 mM; Na phosphate 10 mM; EDTA 0.1 mM; H2O 90%; D2O 10%
vRNA-D2O: INFLUENZA A VIRUS PROMOTER RNA 2 mM; Na phosphate 10 mM; EDTA 0.1 mM; D2O 99.96%
vRNA-CN-H2O: INFLUENZA A VIRUS PROMOTER RNA, [U-13C; U-15N], 0.4 mM; Na phosphate 10 mM; EDTA 0.1 mM; H2O 90%; D2O 10%
vRNA-CN-D2O: INFLUENZA A VIRUS PROMOTER RNA, [U-13C; U-15N], 0.4 mM; Na phosphate 10 mM; EDTA 0.1 mM; D2O 99.96%
conditions_1: ionic strength: 10 mM; pH: 6.5; temperature: 272 K
conditions_2: ionic strength: 10 mM; pH: 6.5; temperature: 278 K
conditions_3: ionic strength: 10 mM; pH: 6.5; temperature: 294 K
vRNA-conditions_4: ionic strength: 10 mM; pH: 6.5; temperature: 303 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | not available | not available | not available |
DQF-COSY | not available | not available | not available |
31P-1H HETCOR | not available | not available | not available |
Software:
xwinnmr v2.6 - collection, processing
SPARKY v3.87 - data analysis
X-PLOR v3.1 - refinement
NMR spectrometers:
- Bruker DRX 400 MHz