BMRB Entry 5553
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5553
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of influenza A virus C4 promoter PubMed: 12582241
Deposition date: 2002-10-10 Original release date: 2003-03-14
Authors: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.
Citation: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.. "A Single-nucleotide Natural Variation (U4 to C4) in an Influenza A Virus Promoter Exhibits a Large Structural Change: Implications for Differential Viral RNA Synthesis by RNA-dependent RNA Polymerase" Nucleic Acids Res. 31, 1216-1223 (2003).
Assembly members:
C4 promoter of influneza A virus, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: Influenzavirus A Taxonomy ID: 197911 Superkingdom: Viruses Kingdom: not available Genus/species: Influenzavirus A not available
Experimental source: Production method: .
Entity Sequences (FASTA):
C4 promoter of influneza A virus: AGUAGAAACAAGGCUUCGGC
CUGCUUUCGCU
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 29 |
15N chemical shifts | 11 |
31P chemical shifts | 18 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | C4 promoter of influneza A virus | 1 |
Entities:
Entity 1, C4 promoter of influneza A virus 31 residues - Formula weight is not available
1 | A | G | U | A | G | A | A | A | C | A | ||||
2 | A | G | G | C | U | U | C | G | G | C | ||||
3 | C | U | G | C | U | U | U | C | G | C | ||||
4 | U |
Samples:
sample_1: C4 promoter of influneza A virus 1 mM; H2O 90%; D2O 10%
sample_2: C4 promoter of influneza A virus 1 mM; D2O 99.96%
sample_3: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; H2O 90%; D2O 10%
sample_4: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; D2O 99.96%
sample_cond_1: pH: .; temperature: . .
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | not available | not available | sample_cond_1 |
DQF-COSY | not available | not available | sample_cond_1 |
3D HCCH-COSY | not available | not available | sample_cond_1 |
Software:
CNS v1.0 - refinement, structure solution
NMRPipe v2.1 - processing
NMR spectrometers:
- Varian INOVA 600 MHz